Pii: s1286-4579(01)01508-8

Monitoring of clinical and laboratory data in two cases Herbert Schmitz a,*, Bernhard Köhler b, Thomas Laue c, Christian Drosten a, Peter J. Veldkamp d, Stephan Günther a, Petra Emmerich a, Hans P. Geisen e, Klaus Fleischer b, Matthias F.C. Beersma d, Achim Hoerauf f aDepartment of Virology, Bernhard-Nocht-Institute for Tropical Medicine, Bernhard-Nocht-Str.74, 20359 Hamburg, Germany bMissionsärztliche Klinik, Würzburg, Germany dDepartment of Infectious Diseases, Leiden University Medical Center, Leiden, The Netherlands eDiakoniekrankenhaus, Schwäbisch Hall, Germany fDepartment of Immunology, Bernhard-Nocht-Institute for Tropical Medicine, Bernhard-Nocht-Str.74, 20359 Hamburg, Germany Received 25 June 2001; accepted 20 August 2001 Abstract
During 2000, four cases of fatal Lassa fever were imported from Africa to Europe. In two patients, consecutive serum samples were available for monitoring of virus load and cytokine levels in addition to standard laboratory data. Both patients had non-specific earlyclinical symptoms including high fever. Patient 1 developed multi-organ failure and died of hemorrhagic shock on day 15 of illness, whilepatient 2 died of respiratory failure due to aspiration without hemorrhage on day 16. Ribavirin was administered to both patients beginningonly on day 11. High serum aspartate aminotransferase and lactate dehydrogenase (LDH) levels were remarkable in both patients. Patient1 had an initial virus load of 106 S RNA copies/ml as measured by real-time RT-PCR. Viremia increased steadily and reached a plateau ofapproximately 108–109 copies/ml 4 days before death, while IFN-γ and TNF-α rose to extremely high levels only shortly before death. Incontrast, in patient 2 the virus load decreased from 107 to 106 copies/ml during the late stage of illness which was paralleled by a decreasein the IFN-γ and TNF-α levels. The IL-10 level increased when specific IgM and IgG appeared. These data suggest that a high virus loadand high levels of pro-inflammatory cytokines in the late stage of Lassa fever play an important role in the pathogenesis of hemorrhage,multi-organ failure, and shock in Lassa fever. 2002 Éditions scientifiques et médicales Elsevier SAS. All rights reserved.
Keywords: Lassa fever; Clinical data; Virus load; Cytokine profiles 1. Introduction
contact, and breast feeding Lassa fever is highlyendemic in Guinea, Sierra Leone, Liberia and Nigeria Lassa fever is the most frequent hemorrhagic fever where it had been first described in the village of Lassa observed in Africa. It is caused by Lassa virus, an arenavirus However, no cases of Lassa fever have been confirmed transmitted to humans by contact with feces or urine of the by virus isolation in countries south of Liberia or north of African rodent Mastomys natalensis. In addition, the blood of infected rodents contains high virus titers and may be asource of transmission during peridomestic rodent hunting In January 2000, Lassa fever caused the death of a in rural West Africa Transmission between humans has 22-year-old German student who returned to Germany from been reported as a result of exposure to blood, sexual Ivory Coast. The Lassa virus was isolated and found to be anew strain (Lassa AV), distinct from known strains ofNigeria, Sierra Leone, Guinea, and Liberia In March2000, a 50-year-old British peacekeeper working in rural * Corresponding author. Tel.: +49-40-42818-460; fax: +49-40-42818- Sierra Leone was evacuated by air ambulance to the United E-mail address: schmitz@bni.uni-hamburg.de (H. Schmitz).
Kingdom where he subsequently died. The clinical diagno 2002 Éditions scientifiques et médicales Elsevier SAS. All rights reserved.
PII: S 1 2 8 6 - 4 5 7 9 ( 0 1 ) 0 1 5 0 8 - 8 H. Schmitz et al. / Microbes and Infection 4 (2002) 43–50 sis of Lassa fever was confirmed in London In April Technologies, Glasgow, UK) and S RNA primers 36E2 2000, a Nigerian male died after being airlifted from Nigeria (ACCGGGGATCCTAGGCATTT) and 80F2 (ATATAAT- to Germany for medical treatment due to neurological disease. He was diagnosed with Lassa fever in Hamburg To quantify the amount of viral RNA, a real-time PCR In July 2000, a 48-year-old physician working in Sierra protocol was established using the LightCycler amplifica- Leone returned to The Netherlands, was diagnosed with tion equipment (Roche, Mannheim, Germany). RT-PCR Lassa fever and died 16 days after onset of fever products were detected using the SybrGreen I dye. The Follow-up specimens were obtained from the student 20-µl reaction mix contained 0.0001% SybrGreen I (Roche, beginning on the 6th day of illness and from the physician Mannheim, Germany) immobilized at the bottom of the beginning on the 9th day of illness. Various laboratory capillary (C. Drosten, unpublished data), 0.6 µl Superscript- parameters of coagulation, hematology, and clinical chem- II/Platinum mix (Life Technologies), 2 µl RNA, 0.2 µM istry were available on these patients from day 6 onward. In primers 36E2 and 80F2, and 10 µl of 2× RT-PCR reaction addition, Lassa virus RNA levels as well as IFN-γ, TNF-α, buffer. The reaction was run as follows: reverse transcrip- and IL-10 levels were monitored using real-time reverse- tion at 50 °C for 20 min; initial denaturation at 95 °C for 5 transcription polymerase chain reaction (RT-PCR) min; amplification for ten cycles at 95 °C for 5 s, 60 °C for and ELISA, respectively. Only a few Lassa fever patients 5 s with a temperature touch-down of 1 °C per cycle, and have been treated in a setting where all of these tests are 72 °C for 25 s; followed by 40 cycles at 95 °C for 5 s, 56 °C available. Therefore, our data represent the first comprehen- for 10 s, 72 °C for 25 s, and 82 °C for 5 s (fluorescence read sive panel of these laboratory data in Lassa fever and may step). The virus load measurement was standardized by lead to a better understanding of the pathophysiology of the using serum of a healthy subject, spiked with ten-fold dilutions of a defined amount of in vitro-transcribed Lassavirus RNA molecules The >95% limit of detection was20 S RNA copies/assay corresponding to 1000 copies/ml of 2. Materials and methods
serum. RT-PCR products were sequenced using the PCRprimers and an automated sequencer.
Vero E6 cells grown in 25-ml flasks were inoculated with a series of dilutions (10–1–10–5) of fresh patient serum, Cytokine levels were quantified in sera by ELISA in the which arrived 8–24 h after venipuncture. In addition, Lassa BSL-4 facility. The following pairs of mAbs were used for virus was isolated from the patients’ serum samples which capture and detection (PharMingen, Heidelberg, Germany): had been shipped on dry ice and had been stored aliquoted TNF-α, mAb-1 and biotinylated mAb-11; IL-10, JES3-9D7 at –70 °C. The growth of virus was demonstrated by immu- and biotinylated JES3-12G8; IFN-γ, NIB42 and biotiny- nofluorescence, using mouse monoclonal antibody (mAb) lated 4SB3. Recombinant human cytokines TNF-α, IL-10 2F1 directed to the Lassa virus nucleocapsid and IFN-γ (PharMingen) were used as concentration stan-dards. Immunoplates (Maxisorp; Nunc, Wiesbaden, Ger- many) were coated with 50 µl capture antibody (1 mg/ml) in0.1 M NaHCO -Na CO buffer (pH 9.6) overnight at 4 °C.
Serum from patients was screened for antibodies against After blocking with 1% bovine serum albumin (BSA), Lassa virus by indirect immunofluorescence (IIF) using plates were washed with PBS–0.05% Tween 20 and incu- cells infected either with the Josiah strain or with the bated overnight at 4 °C with 50 µl serum (diluted 1:2) or homologous isolate of patient 1 (Lassa strain AV). IgM and with dilutions of the reference cytokines. The biotinylated IgG antibodies were detected with anti-µ or anti-γ chain antibodies were used at a concentration 1 mg/ml PB- conjugates, respectively. Serum samples from Lassa fever S–Tween 20–0.1% BSA. Plates were developed after incu- patients in Guinea served as positive controls. Serum bation with streptavidin–peroxidase complex (1:10,000) samples containing specific IgM antibody were retested ( Roche, Mannheim, Germany), using 100 µl tetramethyl- benzidine (6 mg/ml in DMSO) (Roth, Karlsruhe, Germany) G-Sepharose Fast-Flow (Pharmacia, Freiburg, Germany) per well as substrate. Enzyme reactions were stopped with with 0.1 ml protein G-Sepharose-Gel per 0.5 ml serum, 25 µl 4 N H SO /well and product was measured at 450 nm.
diluted 1:10 in phosphate-buffered saline (PBS).
The sensitivity of the ELISA assays was approximately12 pg/ml.
2.3. Detection and quantification of Lassa virus RNAby RT-PCR 2.5. Clinical chemistry, hematology, and coagulation Lassa virus RNA was detected by conventional RT-PCR Aspartate aminotransferase (AST), alanine aminotrans- the Superscript-II/Platinum one-step kit (Life ferase (ALT), lipase, lactate dehydrogenase (LDH), creatine H. Schmitz et al. / Microbes and Infection 4 (2002) 43–50 kinase (CK), gamma glutamyl-transferase, creatinine, bi- Center on the same day with high fever. On the following lirubin, fibrinogen, leukocyte and thrombocyte counts, and day he was admitted to the hospital. He complained of partial thromboplastine time (PTT) were measured by nausea, crampy watery diarrhea, myalgias, arthralgias, and autoanalyzers, in part in the BSL-4 facility.
headache. Any recent percutaneous exposure due to hisprofession or contacts with patients suspected of havinghemorrhagic fevers was denied. His temperature was 3. Results
39.5 °C, blood pressure 120/70, heart rate 80/min, andrespirations 12/min. Physical examination revealed a mod- erately sick male, weight 70 kg, without meningismus,conjunctivitis, pharyngitis, or lymphadenopathy. Chest, ab- Case 1: a 22-year-old female art student (patient 1) from domen, and extremities were normal except for a faint Germany lived for several months in Ivory Coast. In the erythematous rash on the trunk. Thick blood smears were month prior to her illness, she had traveled to Ghana and negative for malaria. On suspicion of typhoid fever cefa- Burkina Faso. In Abidjan, Ivory Coast, on January 2, 2000, mandol and netilmicin were given. He improved with she had a sudden onset of high fever (39 °C) and flu-like resolution of headache, nausea, and diarrhea, while his symptoms. She had been vaccinated against yellow fever temperature remained elevated at 38.5 °C. Since stool and but had not taken malaria prophylaxis. The presumptive blood cultures were negative, cefamandol and netilmicin diagnosis of malaria was made at a local hospital and she were stopped and doxycycline was started. On day 11, he was given artesunate. She returned to Frankfurt, Germany, developed a mild encephalopathy and renal dysfunction.
on the 6th day of illness and was admitted to the hospital at The clinical diagnosis of Lassa fever was made and intra- Schwäbisch Hall with high fever (40 °C) and tonsillitis.
venous ribavirin was started immediately (loading dose: Several thick blood smears were negative for malaria. Three 2000 mg, then 1000 mg qid for 4 days, then 500 mg qid).
days later she was transferred to a hospital specialized in Serum samples were sent to Hamburg, where Lassa virus tropical diseases in Würzburg. On admission, a severe RNA was detected by RT-PCR. Subsequently, he developed pharyngitis and ulcerative tonsillitis were noted, as well as progressive renal failure and hypoxia with diffuse pulmo- shortness of breath with cough, high fever, and diarrhea.
nary infiltrates. He was transferred to the intensive care unit She received ciprofloxacin on an empirical basis. Over the on day 15. The next day he died of respiratory failure due to next days she developed a large pleural effusion. Lassa fever was considered and on the 10th day of illness and a serumsample was sent to the BSL-4 laboratory of the Bernhard- Nocht-Institute, Hamburg. A positive RT-PCR for Lassavirus was reported on the following day, while PCR wasnegative for Ebola, Marburg, Rift valley fever, and The kinetics of the aminotransferases (AST and ALT) are Crimean-Congo virus RNA. IgG or IgM antibodies to any remarkable. Upon presentation, the serum AST and ALT of the aforementioned hemorrhagic fever viruses, including levels of both patients were already slightly elevated. Over Lassa, could not be detected. Intravenous ribavirin treat- the next days, the levels of both enzymes continued to rise, ment was started on the 11th day of illness (16 mg/kg every peaking at days 11 and 12 and maintaining an AST/ALT six h). Despite therapy, encephalopathy developed and an ratio of 10:1 LDH and CK were elevated through- increase in serum lipase indicated a pancreatitis. Due to out the clinical course in both patients In patient 1, progressive renal dysfunction and hypovolemia, the patient they reached a maximum around day 11 and then deceased, was dialyzed and received volume expansion. A massive while they steadily increased to extremely high levels in the hemorrhage developed which could not be corrected by 19 late stage in patient 2. In the latter patient, these values were blood transfusions. The patient experienced seizures and accompanied by myoglobinuria (3+) indicating rhabdomy- died from hemorrhagic shock on the 14th day after onset of olysis. In patient 1, lipase in serum increased sharply illness. Histological post-mortem examination of the liver between days 11 and 12, indicating development of pancre- showed only rare necrotic cells in the intermediate zone of atitis Renal failure was evidenced in both patients by an increase in creatinine levels in the late stage of the Case 2: a 48-year-old male surgeon (patient 2) worked disease. In contrast to patient 2, in patient 1 coagulation for 5 months at a hospital in rural Sierra Leone. He was parameters were progressively impaired (on day 9: throm- healthy until July 10, 2000, when he developed fever and bocytes 100,000/ µl, fibrinogen 300 mg/dl, PTT 55 s; on day malaise. He had been vaccinated against yellow fever and 14: thrombocytes 30 000/µl, fibrinogen 55 mg/dl, PTT had not taken malaria prophylaxis. He received artesunate 60 s). They did not show substantial restoration upon 19 for presumed malaria from a local hospital without subse- blood transfusions. Remarkably, patient 2 showed a throm- quent improvement of his symptoms. On July 14, he bocytosis during the late stage (600,000/ µl on day 14) but returned to The Netherlands for scheduled leave to visit his PTT and fibrinogen were in the normal range and no family and was seen at the Leiden University Medical hemorrhage was seen throughout the disease.
H. Schmitz et al. / Microbes and Infection 4 (2002) 43–50 Fig. 1. Top: kinetics of aminotransferases and lipase of patient 1 and of aminotransferases of patient 2. Bottom: kinetics of LDH, CK, and creatinine in theserum samples of patient 1 and 2. The upper limit values are indicated on the y-axis (normal: AST <15 U/L, ALT <19 U/L, lipase <190 U/L, LDH <240 U/L,CK <70 U/L, creatinine <100 µmol/l).
3.3. Detection of Lassa virus and Lassa virus-specific 3.4. Virus load and cytokine levels Virus load and cytokine levels were monitored retrospec- Virus was detected in serum samples using a fast, tively in follow-up serum samples that had been continu- one-step RT-PCR protocol and previously described primers ously stored frozen at –20 °C. Lassa virus RNA was quan- Lassa virus RNA was also detected in a throat washing tified by real-time RT-PCR In patient 1, a obtained from patient 1 on day 10, when she was admitted concentration of 1 × 106 RNA molecules/ml serum was to the second hospital. Surprisingly, Lassa virus could not found on day 6 of illness. The virus load increased by two be detected in a urine specimen obtained on the same day.
orders of magnitudes until day 10 (2 × 108 molecules/ml), The RT-PCR products of both patients were sequenced as when the viremia approached a plateau phase. Only a small part of the diagnostic procedure. A comparison with known increase to 109 molecules at days 14 and 15 was observed.
Lassa virus sequences showed that patient 1 was infected In contrast, in patient 2 the virus load was 1.9 × 107 with a new strain (designated Lassa AV), differing in copies/ml on day 10 and decreased by one order of nucleotide sequence from the Sierra Leone and Nigeria magnitude during the late stage of illness.
strains by approximately 15%. This was confirmed by Two pro-inflammatory cytokines (TNF-α and IFN-γ) and sequencing the whole S RNA Consistent with its one anti-inflammatory cytokine (IL-10) were measured by geographic origin, the virus of patient 2 was closely related ELISA in the serum samples To circumvent the to the Josiah strain from Sierra Leone (5% difference). In need of virus inactivation, which might have affected the parallel, virus was detected by culturing, using fresh serum cytokine levels, all measurements were performed under (diluted up to 1:1000) of both patients on day 10 of illness.
BSL-4 conditions. Patient 1 showed elevated yet relatively Lassa virus-specific antibodies were detected by IIF. Patient constant serum levels for TNF-α, IFN-γ and IL-10 until day 1 never had detectable anti-Lassa IgG or IgM antibodies, 10, when the TNF-α and IFN-γ levels increased signifi- neither to the Josiah strain nor to the homologous AV strain.
cantly, reaching extremely high levels of 640 pg/ml for In contrast, patient 2 had IgM antibodies on day 13 (see IFN-γ and 380 pg/ml for TNF-α on day 14. In contrast, in while both IgM and IgG antibodies to the Josiah strain patient 2 the TNF-α and IFN-γ levels decreased during the were present on day 16 (titers 1:512 and 1:256, respec- course of illness concurrent with a significant increase in the H. Schmitz et al. / Microbes and Infection 4 (2002) 43–50 Fig. 2. Kinetics of IFN-γ, TNF-α, and IL-10 levels. The concentration in control serum samples of healthy persons was <10 pg/ml for all three parameterstested. The Lassa virus-specific IgM titer is shown for patient 2. Patient 1 did not develop specific IgM and IgG antibodies.
Fig. 3. Measurement of the virus load in consecutive serum samples. The virus load is shown as mean (patient 1, n = 3; patient 2, n = 5). Bars indicatestandard deviation. The correlation coefficient of the standard curve (RNA molecules versus threshold cycle) was r = 0.99.
4. Discussion
and diarrhea. Even in areas endemic for Lassa fever, apresumptive yet erroneous diagnosis of malaria is often The importation of Lassa fever from Africa to other made. In travelers returning from Africa, the most common regions of the world is rare However, during 2000 causes of a febrile illness are malaria and typhoid fever. This four cases of imported Lassa fever occurred in Europe; two diagnostic dilemma is well illustrated by both of our cases.
cases in Germany one case in The Netherlands In the patients, the AST and ALT were elevated at the and one additional case in the United Kingdom uncommon ratio of 10:1. A concomitant elevation of CK Lassa fever is classified as a hemorrhagic fever, but and LDH in serum, as well as myoglobin in urine suggests clinical diagnosis is difficult because obvious bleeding is rhabdomyolysis rather than hepatocytolysis as the main often absent even late in the course of illness Further- cause of these enzyme elevations. This view is also sup- more, patients present with a wide range of non-specific ported by histological post-mortem examination of the liver clinical symptoms such as high fever, headache, sore throat, of patient 1 showing only rare necrotic areas. In view of H. Schmitz et al. / Microbes and Infection 4 (2002) 43–50 these data, the suspicion of Lassa fever should arise when a ine levels during Lassa fever clearly show that depending on patient presents with high fever following a recent visit to the time of sampling, either early or late during the course West-Africa, when malaria is ruled out, the fever persists of the disease, strongly divergent cytokine level can be despite antibiotic treatment, and blood cultures are negative.
found. There is indeed evidence that patients with a viral Laboratory data supporting this suspicion are elevated hemorrhagic shock may die due to a systemic inflammatory serum levels of CK, LDH, AST, and ALT as well as a high response syndrome, a condition which is characterized by expression of high levels of pro-inflammatory cytokines In patient 1, the kinetic of the virus load roughly In patients with Argentine hemorrhagic fever, correlates with the clinical course of the disease. The virus which is also caused by an arenavirus, increased levels of load increased dramatically until day 10, when it ap- TNF-α were directly related to severity of illness proached a plateau phase. During this phase the clinical which was reproduced in a guinea-pig model of arenavirus complications developed. In patient 2, the virus load was infection Recently, arenavirus-induced systemic shock lower than in patient 1 and declined from day 10 to day 16 and death was prevented in a mouse model by blocking the of the disease. Although the illness was generally less severe receptor for lymphotoxin- , which is a cytokine related to than in patient 1, there was no improvement of the clinical TNF-α TNF-α can cause thrombocytopenia and it condition evident during this period. Ribavirin was given is known to induce endothelial damage via apoptosis late in the course of illness in both patients, and at least in In patient 1, TNF-α reached serum levels that were compa- patient AV the drug did not obviously alter the clinical rable to concentrations causing endothelial injury in animal course or reduced the virus load significantly. This is models Ineffective control of virus replication in the consistent with previous reports showing a decreased mor- early phase of the disease probably resulted in the high virus tality in Lassa fever patients mainly when ribavirin is load. This may have triggered the expression of high levels administered within 6 days after onset of fever The of pro-inflammatory cytokines in the late phase, thus increasing lipase and creatinine levels and the development contributing to the severity of illness and subsequently of neurological signs late in the disease of patient 1 and leading to hemorrhagic shock. The lack of IgM or IgG the late creatinine increase in patient 2 may suggest that the antibody production in patient 1 may also be the result of a virus had reached additional target organs. However, it is dysregulated and ineffective immune response.
also conceivable that pancreatitis and encephalopathy may In contrast to patient 1, decreasing levels of TNF-α and be the result of secondary effects such as toxic cytokine IFN-γ were measured during the course of illness in patient 2 simultaneously with a decrease in the virus load. Impor- Coagulation parameters were marginally altered in the tantly, this patient did not die from hemorrhagic shock. This beginning of the disease of patient 1. Even in the final stage strengthens the hypothesis that an imbalance between pro- the coagulation parameters were only moderately impaired and anti-inflammatory cytokines plays an important role in which cannot explain the massive hemorrhage occurring Lassa fever hemorrhagic shock. The decrease in pro- shortly before death. Apart from thrombocytopenia, other inflammatory cytokines is paralleled by an increase in the mechanisms were probably involved in the pathogenesis of anti-inflammatory cytokine IL-10 and the appearance of the shock syndrome such as prostacycline activation or IgM and IgG antibodies. This further indicates an effective expression of toxic cytokine levels. In fact, the fatal and correctly regulated cytokine response. This situation bleeding was accompanied by a sharp rise in the concen- may be similar to that of patients with Ebola fever, where tration of TNF-α and IFN-γ. The levels of TNF-α were also lethal, mild or even asymptomatic infections can be higher than usually seen in septic patients before death observed. As had been shown for patients with asymptom- The continuous antibiotic treatment and the nega- atic Ebola virus infection, in whom virus replication was tive blood cultures exclude septic shock due to bacterial controlled effectively by an initial increase of IL-1 , IL-6 and TNF-α followed by a downregulation to baseline levels So far, cytokine levels have not been documented in the outcome of Lassa fever may also depend on an patients with Lassa fever. After completing this manuscript early cytokine response. In any case, neutralizing antibodies Mahntey et al. measured various cytokine or cytokine do not play a role in acute Lassa or Ebola infection, since receptor concentrations in samples of Lassa fever patients virus and antibody may simultaneously be found in the collected in 1997 in Sierra Leone and Guinea. They con- clude that low levels of IL-8, IP-10, as well as TNF-α (with Taken together, the results of this study suggest that a one exception) are associated with fatal outcome. However, dysregulated and ineffective cytokine response, leading to in the six lethal cases listed, only single serum samples or high levels of virus and pro-inflammatory cytokines in the samples 1 day apart, taken 5–18 days after onset of late stage of the disease, is important in the pathogenesis of symptoms, were available. Moreover, the cytokine data hemorrhage and shock in Lassa fever. Further studies on were not related to death by hemorrhagic shock but to fatal both the cellular immune response and cytokine response in outcome, which may happen for various reasons (i.e. organ patients with Lassa fever are required to deepen our under- failure) during Lassa fever. Our longitudinal data on cytok- standing of the pathophysiology of Lassa virus infection.
H. Schmitz et al. / Microbes and Infection 4 (2002) 43–50 Acknowledgements
[18] Y. Hirabayashi, S. Oka, H. Goto, K. Shimada, T. Kurata, S.P. Fisher- Hoch, J.B. McCormick, An imported case of Lassa fever with lateappearance of polyserositis, J. Infect. Dis. 158 (1988) 872–875.
The authors thank Marlis Badusche and Gabriele Riet- [19] M.S. Mahdy, W. Chiang, B. McLaughlin, K. Derksen, B.H. Truxton, dorf for excellent technical assistance.
K. Neg, Lassa fever: the first confirmed case imported into Canada,Can. Dis. Wkly Rep. 15 (1989) 193–198.
[20] R.M. Zweighaft, D.W. Fraser, M.A. Hattwick, W.G. Winkler, References
W.C. Jordan, M. Alter, M. Wolfe, H. Wulff, K.M. Johnson, Lassafever: response to an imported case, N. Engl. J. Med. 297 (1977) [1] J. ter Meulen, I. Lukashevich, K. Sidibe, A. Inapogui, M. Marx, A. Dorlemann, M.L. Yansane, K. Koulemou, J. Chang-Claude, [21] R.M. van der Heide, Een patient met Lassa koorts uit Opper-Volta, H. Schmitz, Hunting of peridomestic rodents and consumption of herkend in Nederland, Nederlands Tijdschrift voor Geneeskunde 314 their meat as possible risk factors for rodent-to-human transmission of Lassa virus in the Republic of Guinea, Am. J. Trop. Med. Hyg. 55 [22] J.B. McCormick, I.J. King, P.A. Webb, K.M. Johnson, R. O’Sullivan, E.S. Smith, S. Trippel, T.C. Tong, A case-control study of the clinical [2] J.B. McCormick, P.A. Webb, J.W. Krebs, K.M. Johnson, E.S. Smith, diagnosis and course of Lassa fever, J. Infect. Dis. 155 (1987) A prospective study of the epidemiology and ecology of Lassa fever, J. Infect. Dis. 155 (1987) 437–444.
[23] J.B. McCormick, I.J. King, P.A. Webb, C.L. Scribner, R.B. Craven, [3] T.P. Monath, P.E. Mertens, R. Patton, C.R. Moser, J.J. Baum, K.M. Johnson, L.H. Elliott, R. Belmont-Williams, Lassa fever.
L. Pinneo, G.W. Gary, R.E. Kissling, A hospital epidemic of Lassa Effective therapy with ribavirin, N. Engl. J. Med. 314 (1986) 20–26.
fever in Zorzor, Liberia, March–April 1972, Am. J. Trop. Med. Hyg.
[24] M.V. Solbrig, J.B. McCormick, Lassa fever: central neurvous system manifestations, J. Trop. Geograph. Neurol. 1 (1991) 23–30.
[4] D.E. Carey, G.E. Kemp, H.A. White, L. Pinneo, R.F. Addy, A.L. Fom, [25] S.P. Fisher-Hoch, S.W. Mitchell, D.R. Sasso, J.V. Lange, R. Ramsey, G. Stroh, J. Casals, B.E. Henderson, Lassa fever. Epidemiological J.B. McCormick, Physiological and immunologic disturbances asso- aspects of theepidemic, Jos, Nigeria, Trans. R. Soc. Trop. Med. Hyg.
ciated with shock in a primate model of Lassa fever, J. Infect. Dis. 155 [5] J.D. Frame, J.M. Baldwin, D.J. Gocke, J.M. Troup, Lassa fever, a new virus disease of man from West Africa. I. Clinical description and [26] E. Presterl, T. Staudinger, M. Pettermann, A. Lassnigg, H. Burgmann, pathological findings, Am. J. Trop. Med. Hyg. 19 (1970) 670–676.
S. Winkler, M. Frass, W. Graninger, Cytokine profile and correlationto the APACHE III and MPM II scores in patients with sepsis, Am.
[6] M.D. Bowen, P.E. Rollin, T.G. Ksiazek, H.L. Hustad, D.G. Bausch, J. Respir. Crit. Care Med. 156 (1997) 825–832.
A.H. Demby, M.D. Bajani, C.J. Peters, S.T. Nichol, Genetic diversityamong Lassa virus strains, J. Virol. 74 (2000) 6992–7004.
[27] F. Carlstedt, L. Lind, B. Lindahl, Proinflammatory cytokines, mea- [7] S. Günther, P. Emmerich, T. Laue, O. Kühle, M. Asper, A. Jung, sured in a mixed population on arrival in the emergency department, T. Grewing, J. ter Meulen, H. Schmitz, Imported, Lassa fever in are related to mortality and severity of disease, J. Intern. Med. 242 Germany: molecular characterization of a new Lassa virus strain, Emerg. Infect. Dis. 6 (2000) 466–476.
[28] J.A. Avontuur, T.C. Stam, M. Jongen-Lavrencic, J.G. van Amsterdam, [8] WHO, Lassa fever imported case, UK, Weekly Epidemiological Rec.
A.M. Eggermont, H.A. Bruining, Effect of L-NAME, an inhibitor of nitric oxide synthesis, on plasma levels of IL-6, IL-8, TNF alpha and [9] WHO, Lassa fever, imported case, Germany, Weekly Epidemiological nitrite/nitrate in human septic shock, Intensive Care Med. 24 (1998) [10] WHO, Lassa fever, imported case, Netherlands, Weekly Epidemio- [29] M.A. Martinez, J.M. Pena, A. Fernandez, M. Jimenez, S. Juarez, R. Madero, J.J. Vazquez, Time course and prognostic significance of [11] C.A. Heid, J. Stevens, K.J. Livak, P.M. Williams, Real-time quanti- hemostatic changes in sepsis: relation to tumor necrosis factor-alpha, tative PCR, Genome Res. 6 (1996) 986–994.
Crit. Care Med. 27 (1999) 1303–1308.
[12] T. Laue, P. Emmerich, H. Schmitz, Detection of dengue virus RNA in [30] J.S. Brauner, L.E. Rohde, N. Clausell, Circulating endothelin-1 and patients after primary or secondary dengue infection by using the tumor necrosis factor-alpha: early predictors of mortality in patients TaqMan automated amplification system, J. Clin. Microbiol. 37 with septic shock, Intensive Care Med. 26 (2000) 305–313.
[31] S. Mahanty, D.G. Bausch, R.L. Thomas, A. Goba, A. Bah, C.G. Pe- [13] F.T. Hufert, W. Ludke, H. Schmitz, Epitope mapping of the Lassa ters, P.E. Rollin, Low levels of interleukin-8 and interferon-inducible virus nucleoprotein using monoclonal anti-nucleocapsid antibodies, protein-10 in serum are asscociated with fatal infections in acute Lassa fever, J. Inf. Dis. 183 (2001) 1713–1721.
[14] D.D. Auperin, J.B. McCormick, Nucleotide sequence of the Lassa [32] B. Beutler, G.E. Grau, Tumor necrosis factor in the pathogenesis of virus (Josiah strain) S genome RNA and amino acid sequence infectious diseases, Crit. Care Med. 21 (1993) S423–435.
comparison of the N and GPC proteins to other arenaviruses, Virology [33] R.M. Strieter, S.L. Kunkel, R.C. Bone, Role of tumor necrosis factor-alpha in disease states and inflammation, Crit. Care Med. 21 [15] K. Lunkenheimer, F.T. Hufert, H. Schmitz, Detection of Lassa virus RNA in specimens from patients with Lassa fever by using thepolymerase chain reaction, J. Clin. Microbiol. 28 (1990) 2689–2692.
[34] K.J. Tracey, A. Cerami, Tumor necrosis factor: an updated review of [16] A.H. Demby, J. Chamberlain, D.W. Brown, C.S. Clegg, Early its biology, Crit. Care Med. 21 (1993) S415–422.
diagnosis of Lassa fever by reverse transcription-PCR, J. Clin.
[35] G. Friedman, S. Jankowski, A. Marchant, M. Goldman, R.J. Kahn, J.L. Vincent, Blood interleukin 10 levels parallel the severity of septic [17] G.P. Holmes, J.B. McCormick, S.C. Trock, R.A. Chase, S.M. Lewis, shock, J. Crit. Care 12 (1997) 183–187.
C.A. Mason, P.A. Hall, L.S. Brammer, G.I. Perez-Oronoz, M.K. Mc- [36] H.D. Volk, P. Reinke, D. Krausch, H. Zuckermann, K. Asadullah, Donnell, Lassa fever in the United States. Investigation of a case and J.M. Muller, W.D. Docke, W.J. Kox, Monocyte deactivation-rationale new guidelines for management, N. Engl. J. Med. 323 (1990) for a new therapeutic strategy in sepsis, Intensive Care Med. 22 H. Schmitz et al. / Microbes and Infection 4 (2002) 43–50 [37] R.F. Marta, V.S. Montero, C.E. Hack, A. Sturk, J.I. Maiztegui, [42] M.R. Slowik, W. Min, T. Ardito, A. Karsan, M. Kashgarian, F.C. Molinas, Proinflammatory cytokines and elastase-alpha-1- J.S. Pober, Evidence that tumor necrosis factor triggers apoptosis in antitrypsin in Argentine hemorrhagic fever, Am. J. Trop. Med. Hyg.
human endothelial cells by interleukin-1-converting enzyme-like protease-dependent and -independent pathways, Lab. Invest. 77 [38] M.V. Heller, M.C. Saavedra, R. Falcoff, J.I. Maiztegui, F.C. Molinas, Increased tumor necrosis factor-alpha levels in Argentine hemor-rhagic fever letter, J. Infect. Dis. 166 (1992) 1203–1204.
[39] J.F. Aronson, N.K. Herzog, T.R. Jerrells, Tumor necrosis factor and J.S. Schechner, M.I. Lorber, J.S. Pober, G. Tellides, Human, TNF can the pathogenesis of Pichinde virus infection in guinea pigs, Am.
induce nonspecific inflammatory and human immune-mediated mi- J. Trop. Med. Hyg. 52 (1995) 262–269.
crovascular injury of pig skin xenografts in immunodeficient mouse [40] M.T. Puglielli, J.L. Browning, A.W. Brewer, R.D. Schreiber, hosts, J. Immunol. 164 (2000) 6601–6609.
W.J. Shieh, J.D. Altman, M.B. Oldstone, S.R. Zaki, R. Ahmed,Reversal of virus-induced systemic shock and respiratory failure by blockade of the lymphotoxin pathway, Nat. Med. 5 (1999) M.C. Georges-Courbot, J. Lansoud-Soukate, M. Capron, P. Debre, J.B. McCormick, A.J. Georges, Human asymptomatic Ebola infection [41] I. Michelmann, D. Böckmann, W. Nürnberger, S. Eckhof-Donovan, and strong inflammatory response, Lancet 355 (2000) 2210–2215.
S. Burdach, U. Göbel, Thrombocytopenia and complement activationunder recombinant TNF alpha/IFN gamma therapy in man, Ann.
[45] G.M. Ignatyev, Immune response to filovirus infections, Curr. Top.
Microbiol. Immunol. 235 (1999) 205–217.

Source: http://www.enivd.de/LASSA-IMP.PDF