Microsoft word - doxycycline vascular type of ehlers.docx

Doxycycline ameliorates the susceptibility to aortic lesions in a mouse model for the
vascular type of Ehlers-Danlos syndrome
Wilfried Briest, Timothy K. Cooper, Hyun-Jin Tae, Melissa Krawczyk, Nazli B. McDonnell,
Mark I. Talan Laboratory of Cardiovascular Sciences (W.B., H.J.T., M.K., M.I.T.) and;
Laboratory of Clinical Investigation (N.B.M.), National Institute on Aging, Baltimore, MD;
Department of Comparative Medicine, PSU Hershey Medical Center, Hershey, PA (T .K.C.)
Page1of26
Copyright 2011 by the American Society for Pharmacology and Experimental
Therapeutics.JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx
Running Title Page
VEDS-treatment by doxycycline
Wilfried Briest Ferdinand-Lassalle-Str. 16 04109 Leipzig, Germany Phone: +49 341 3086799
Fax: +49 3221 2343956 E-mail: wilfried.briest@arcor.de
26 pages, no table, 5 figures, 2 supplemental figures, 40 references Word count in the
Introduction: 393 Discussion: 1347
Abbreviations: AAA, abdominal aortic aneurysm; ANOVA, analysis of variance; AR,
adrenergic receptor; AU, arbitrary unit; BCA, bicinchoninic acid; COL3A1, alpha-1 chain of
collagen type III; FDA, US Food and Drug Administration; HT, heterozygous knockout
mouse; MMP, matrix metalloproteinase; OMIM, database Online Mendelian Inheritance in
Man; PCR, polymerase chain reaction; SEM, standard error of the mean; vEDS, vascular
form of Ehlers-Danlos syndrome; WT, wild-type mice
Section: Cardiovascular
Page2of26
JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx
Abstract Aims: The vascular form of Ehlers-Danlos syndrome (vEDS), a rare disease with
grave complications due to rupture of major arteries is caused by mutations of collagen type
III (COL3A1). The only, recently proven, preventive strategy consists of reduction of arterial
wall stress by beta-adrenergic blockers. Heterozygous Col3a1 knockout mouse (HT) has
reduced expression of collagen III and recapitulates features of a mild presentation of the
disease. The objective of this study was to determine whether change of the balance
between synthesis and degradation of collagen by chronic treatment with doxycycline, a
nonspecific matrix metalloproteinase (MMP) inhibitor, could prevent the development of
vascular pathology in HT mice. Methods and Results: Following 3-mo treatment with
doxycycline or placebo, 9-mo old HT or wild-type mice (WT) mice were subjected to a
surgical stressing of the aorta. A three fold increase in stress-induced aortic lesions found in
untreated HT one week after intervention (cumulative score 4.5±0.87 vs. 1.3±0.34 in wild-
type, p<0.001) was fully prevented in the doxycycline treated group (1.1±0.56, p<0.001). The
untreated HT showed increased MMP-9 activity in the carotid artery and decreased collagen
content in the aorta, however, in doxycycline treated animals there was normalization to the
levels observed in WT. Conclusion: Doxycycline treatment inhibits activity of tissue MMP
and attenuates the decrease in the collagen content in aortas of mice haploinsufficient for
collagen III, as well as prevents the development of stress-induced vessel pathology. The
results suggest that doxycycline merits clinical testing as a treatment for vEDS.
Page3of26
JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx
Introduction
The vascular form of Ehlers-Danlos syndrome (vEDS, OMIM 130050) is a rare autosomal
dominant disorder (incidence 1:100,000)(Germain, 2007) caused by mutations in the alpha-1
chain of type III collagen (COL3A1)(Pope et al., 1975; Smith et al., 1997; Pyeritz, 2000;
Germain, 2007). Type III collagen is a homotrimeric fibrillar collagen found abundantly in the
wall of arteries, the gastrointestinal tract, as well as in the uterus, and other tissues. The
quantitative or qualitative deficit of structurally normal collagen III in vEDS and corresponding
changes in the wall structure are responsible for major complications observed in afflicted
individuals: arterial, bowel, and uterine ruptures. As a result of these dramatic complications,
life expectancy in vEDS is shortened to a mean of <50 years (Pepin et al., 2000; Watanabe
et al., 2007). Until very recently, there was no evidence based treatment or preventive
strategy available (Watanabe and Shimada, 2008). However, in the just completed first
multicenter randomized trial, almost 4 years (47 months) treatment with celiprolol – a long-
acting β1 antagonist with partial β2 agonist properties used for treatment of hypertension –
decreased the incidence of arterial ruptures in patients with clinical diagnosis of vEDS (Ong
et al., 2010). Celiprolol was uptitrated every 6 months by steps of 100 mg to a maximum of
400 mg twice daily.
More than 150 mutations in the COL3A1 gene leading to synthesis of an abnormal type III
procollagen protein have been presently identified (Stenson, 2009). Most of the mutations
are single-nucleotide substitutions of the canonical glycine residues in the triple-helical
domain of the proα1(III) chain, resulting in a regular quantity of abnormal collagen III;
however haploinsufficiency of collagen III (reduced quantity of normal collagen III) is also
reported in vEDS patients (Schwarze et al., 2001; Khalique et al., 2009).
Page4of26
JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx
We have shown recently that haploinsufficiency for Col3a1 in mice recapitulates mild
presentation of vEDS in humans and thus can serve as an experimental model in the search
for effective treatments (Cooper et al., 2010).
It has been reported that in the third stage of aneurysm development, rapid expansion and
increased risk of rupture are associated with accelerated degradation of collagen (Thompson
and Baxter, 1999). Doxycycline, a tetracycline antibiotic and broad spectrum
metalloproteinase (MMP) inhibitor, has been successfully tested in pilot clinical trials for the
treatment of abdominal aortic aneurysms (Curci et al., 2000; Mosorin et al., 2001; Baxter et
al., 2002; Lindeman et al., 2009). Doxycycline, given in a subantimicrobal dose, is also the
only MMP inhibitor approved by FDA. It is currently used for treatment of periodontal disease
(Wennstrom et al., 2001) and rosacea (Del Rosso et al., 2007). We hypothesized that MMP
inhibition in the mouse experimental model of vEDS would shift the balance between
collagen degradation and synthesis in the vascular wall and protect against vascular
damage.
Methods
See Supplementary Methods for description of quantification of collagen content in skin and
description of the colons biomechanical properties detection.
Subjects
Heterozygous Col3a1 deficient mice (strain C.129S4(B6)-Col3a1tm1Jae/J) (Liu et al., 1997)
were rederived (Jackson Lab, Bar Harbor,ME) and bred in the vivarium of the National
Institute on Aging. The Col3a1 genotype was determined by PCR (5ʼ
CTTCTCACCCTTCTTCATCCC 3ʼ, 5ʼ AGCCTGTTCAAATCGGTACC 3ʼ and neo 5ʼ
GCTATCAGGACATAGCGTTGG 3ʼ) after weaning, and genotypes were reconfirmed at
Page5of26
JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx
the end of the experiments. Animals were housed and studied in conformance with the NIH
Guide for the Care and Use of Laboratory Animals, Manual 3040-2 (1999), with institutional
Animal Care and Use Committee approval (363-LCS). Mice were maintained on ad libitum
food (NIH-07 Mouse/Rat diet) with permanent access to filtered water.
Experimental protocol
Two groups of six months old female HT mice were treated for 3 months with doxycycline
(compound ID 5281011). Treatment was provided with food containing 200 mg/kg or 800
mg/kg of doxycycline (“Dox Diet” pellets, BioServ, Frenchtown, NJ). Since preliminary
measured food intake of these mice was averaged at 3.5 g/day and average body weight of
animals was 25 g, the average drug dose for low and high dose groups was 25 (Doxy25) or
100 (Doxy100) mg/kg per day, respectively. Untreated WT and HT mice were maintained on
a regular diet (NIH-07 Mouse/Rat diet) and served as controls. After 3 months, under general
inhalation anesthesia (2% of isoflurane in oxygen) and aseptic conditions, the abdominal
aortas were surgically exposed and stressed by the following technique: the blood flow was
stopped by occluding the abdominal aorta against the spinal column with a sterile cotton-tip
applicator pressed at the level of the renal arteries. After 30 seconds a second applicator
was pressed at the level of iliac bifurcation and the first applicator was abruptly released,
followed by release of the second applicator. According to Weinbrenner et al (2002), who
used a similar procedure for remote preconditioning in rats, the mean arterial pressure had
been elevated by about 13% immediately after occlusion. The abdominal incision was
sutured closed and mice returned to home cages. The treatment was continued after the
intervention. One week after intervention mice were euthanized by an overdose of isoflurane.
Blood was collected, and aortas and segments of colon and skin were harvested.
Page6of26
JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx
Tissue collection
Blood was collected from the left ventricle. The abdominal aorta was exposed and opened at
the bifurcation. A 3% (w/v) agarose solution (SeaPlaque GTG Agarose, low-melt, Lonza,
Allendale, NJ) diluted in physiological salt solution and colored with Evans blue (Sigma-
Aldrich) at 37°C was injected through the left ventricle into the aorta to prevent collapse
during tissue processing. The aorta was dissected free from the surrounding connective
tissue and pinned onto a wax block before fixation in 10% formalin for 2 days. Cross sections
of the aorta (2 mm in thickness) were ordered in 8% agar to create a block with an average
of 20 sections of the aorta. The block was stored in 70% ethanol until it was processed and
embedded in paraffin (AML Lab, Baltimore, MD). Samples of transverse colon were used for
the determination of biomechanical properties. Left and right carotid arteries and a piece of
the tail and the skin from the back were snap-frozen in liquid nitrogen.
Histological analysis
5 μm sections from each block of aortic sections were stained with hematoxylin and eosin
(H&E) and Massonʼs trichrome. Two veterinary pathologists (TKC, HJT) blinded to genotype
independently evaluated the stained sections to count the number of lesions present in
aortas and rate the severity of each lesion on a subjective 1-4 scale according to previously
reported criteria (Cooper et al., 2010). Because of their mild nature, as well as a high
frequency in both sexes and genotypes, grade 1 lesions were excluded from statistical
analysis. The sum of the scores of lesions > grade 2 was added for each animal to produce a
cumulative score.
Page7of26
JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx
Collagen detection by picro-sirius red staining
To examine collagen content in the vessel wall, 5 μm sections of abdominal aorta were
stained with picro-sirius red. Digital images of stained sections were obtained from light
microscopy using polarized filters and analyzed using a digital imaging analysis system
(MCID, InterFocus Imaging Ltd, Cambridge, UK). The total collagen content in aortic wall as
well as collagen content of tunicae adventitia and media separately were calculated as a
percentage of the total area of the wall or its respective components (Seeland et al., 2007).
Assessment was performed by a single individual (HJT) blinded to genotype of the animal.
Detection of MMP activity
Extracellular matrix proteins were isolated from right carotid artery and approximately 5 mg
frozen skin from each animal. Proteins were extracted with 40 μl or 20-fold volume RIPA
buffer (50 mM Tris-Cl pH 7.4, 150 mM NaCl, 1% (v/v) NP-40, 1 mM EDTA, 0.25% Na-
deoxycholat, protease inhibitor mix M (SERVA Electrophoresis, Heidelberg, Germany),
respectively), overnight at 4°C. Protein content was determined with the BCA method
(BCATM protein assay kit, Pierce, Rockford, IL).
Gelatinase activity was measured as described previously (Briest et al., 2001). Gelatin (0.1%
(w/v), (SERVA Electrophoresis, Heidelberg, Germany) was added to standard Laemmli
acrylamide polymerization mixture. Tissue extract was mixed 1:2 with sample buffer (250
mM Tris-Cl pH 6.8, 10% (w/v) SDS, 20% (v/v) glycerol, 0.005% (w/v) bromphenol blue).
Serum was diluted 1:10 with electrophoresis buffer (2.5 mM Tris, 20 mM glycine, 0.005%
SDS) and mixed 1:2 with sample buffer. Twenty microliters were loaded following 10 min
incubation at room temperature without boiling. Following electrophoresis at 90 V, the gels
were soaked in 2.5% (w/v) Triton X-100, incubated 2-3
Page8of26
JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx
days at 37°C in gelatin digestion buffer (50 mM Tris-Cl pH 8.0, 8 mM CaCl2, 10 mM ZnSO4,
0.02% (w/v) NaN3), stained in 0.05% Coomassie blue R-250 (SERVA Electrophoresis,
Heidelberg, Germany) in acetic acid:methanol:water (1:4.5:4.5 by volume), destained in 10%
acetic acid, 5% methanol and scanned for lysis band intensity. The lysis band intensity is
proportional to gelatinase activity and was quantified densitometrically by the program “one
dimensional scan software” (Scanalytics, Rockville, MD, USA). The result, a number
between 0.07 and 3.75, was normalized to the protein content by dividing the densitometry
result with the relative optical density from the BCA protein assay kit result. The result was
used for the analysis as the arbitrary unit (AU). For the total MMP activity results of lysis
bands of proMMP-9, active MMP-9, proMMP-2 and active MMP-2 was added. A protein size
marker (Page Ruler Plus, Fermentas, St. Leon-Rot, Germany) was used to determine the
correct size.
Statistical analysis
All data are presented as mean ± SEM. The actual number of animals per group might vary
in different measurements due to technical reasons and presented in the
corresponding figures. A multiple-sample comparison (ANOVA and the multiple range test as
post hoc test using the criterion of the least significant differences) was applied to test the
differences between groups. Statistical significance was accepted at p<0.05.
Results Doxycycline treatment normalized MMP-activity in carotid arteries
Gelatinases MMP-2 and MMP-9 were detected in extracts from carotid arteries both as an
inactive pro-form and as an active form (Fig. 1a). All 4 bands were summarized as total
MMP, which was significantly elevated in untreated HT mice compared to WT, and were
normalized by doxycycline treatment in HT (Fig. 1b). Pro-
Page9of26
JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx
forms of both MMPs (data not shown) and active MMP-2 (Fig. 1d) were unchanged in either
untreated HT or in HT treated by doxycycline relative to WT. However, there was a
significant increase in active MMP-9 in untreated HT, which was reduced in a dose-
dependent manner by doxycycline (Fig. 1c). The MMP-9 activity in HT after doxycycline
treatment was statistically not different from WT mice with normal diet.
Doxycycline treatment attenuates the reduction of collagen in the aorta
The collagen content was measured by picro-sirius staining in the abdominal aorta, since
statistically significant differences in collagen content between wild-type and heterozygous
mice had been detected previously specifically in that segment of aorta.(Cooper et al., 2010)
In agreement with our previous findings there was significantly less total collagen detected in
untreated HT mice than in WT (Fig. 2a). In the Doxy 25 group the collagen content remained
significantly reduced compared to WT. However, in the Doxy100 group the collagen content
increased and became similar to the WT. The change in the total collagen content of the
aorta was a result of its reduction in the tunica media of untreated and Doxy 25 treated mice
(Fig. 2b), while the collagen content in the tunica adventitia did not differ significantly
between groups (Fig. 2c). The differences in collagen content were not accompanied by
changes in luminal radius or thickness of the tunica media (Suppl. Fig. 1). The detection of
collagen type I in the skin revealed no significant differences between wild-type and
untreated heterozygous mice with normal diet. There was also no effect of doxycycline
treatment on skin collagen (Suppl. Fig. 2).
Doxycycline treatment prevented stress induced vessel pathology
One week after surgical intervention, histological evaluation of aortas revealed 3 fold more
vessel pathology in untreated HT than in WT mice (p<0.001, Fig. 3).
Page 10 of 26
JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx
Doxycycline treatment prevented this increase in a dose-dependent fashion, significantly
reducing cumulative score in doxycycline treated HT groups compared to untreated HT mice
(p<0.001) and bringing the cumulative score to the level of WT (Fig. 3): There were no
differences in the cumulative scores between WT and HT mice treated with doxycycline.
Colon biomechanics
The biomechanical properties of the colon were not changed by doxycycline treatment (data
not shown). The stiffness and the maximal holding pressure of the colon from heterozygous
animals with and without doxycycline treatment were both reduced in comparison to wild-
type mice.
MMP-activity in blood serum and skin
The MMP activity was analyzed in the serum (Fig. 4a). There was a different level of
detection of pro- and active MMPs compared to the carotid arteries extract: There was
virtually no detectable pro-form of MMP-2 either in wild-type or heterozygous mice.
Furthermore, there were no significant changes between WT and HT both untreated and
treated with doxycycline (Fig. 4b).
In contrast to the serum, only pro-forms and no active MMP-9 were detectable in the skin
(Fig. 5a). There was remarkably more pro-MMP-2 detectable, and some active MMP-2.
Similar to the vessel tissue extract, total MMP (Fig. 5b) was significantly elevated in
untreated HT. This was reduced to the level of WT in the HT group treated with the higher
dose of doxycycline. The pattern of total MMP was reflected in the pattern of proMMP-2: It
was elevated in untreated HT and normalized by high dose doxycycline (Fig. 5d). However
proMMP-9 was not affected either by genotype or treatment (Fig. 5c).
Page 11 of 26
JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx
Discussion
Consistent with expectations, we have shown that in the mouse model of collagen III
haploinsufficiency chronic MMP-inhibition by doxycycline treatment prevented the increased
MMP activity in the carotid artery and the skin present in untreated HT mice. The
normalization of MMP activity was accompanied by partial normalization of collagen content
in the tunica media of the abdominal aorta in HT mice. This mild increase in collagen
accumulation seems to be sufficient to strengthen the vessel, because the increase in stress
induced vessel pathology in untreated HT mice was prevented by doxycycline treatment.
Therefore, on the basis of these results doxycycline therapy might be considered as a
treatment for vEDS, at least of the haploinsufficient type.
The rational for the only available preventive strategy for vEDS by β1-AR blocker was mainly
mechanical – to reduce the arterial wall stress by controlling the rate of increase of pressure
over time in the pulse wave (dP/dt) and, thus, to reduce “wearing and tearing” of arterial wall. The celiprolol, however, used in the successful clinical trial was not a typical β1-AR blocker. It combines β1-AR inhibition with some properties of β2- AR stimulation and was proven beneficial for vEDS patients without affecting hemodynamic variables.(Ong et al., 2010) Heart rate or systolic and diastolic pressure were not decreased and pulse pressure was even elevated in patients on celiprolol. It was not tested if celiprolol would be able to reduce a stress response. A possible alternative mechanism of celiprololʼs protective effect in vEDS based on stimulation of transforming growth factor β and subsequently stimulation of collagen synthesis was discussed (Brooke, 2010; Ong et al., 2010). However, this hypothesis was not proven. Page 12 of 26 JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx The inhibition of MMPs – the rationale of this paper – targeted the balance of collagen homeostasis on the degradation side. Inhibition of MMPs by the broad- spectrum MMP inhibitor marimastat had been suggested as a potential therapy for vEDS (Sastry, 2002). There have been successful clinical trials testing doxycycline as a MMP inhibitor in patients with abdominal aortic aneurysm (Curci et al., 2000; Mosorin et al., 2001; Baxter et al., 2002; Lindeman et al., 2009). One week doxycycline treatment effectively suppressed the MMP-activity in the wall of the aortic aneurysm (Curci et al., 2000); however its actual clinical effect was not evaluated. In contrast to our results, a reduction of MMP-2 activity associated with doxycycline treatment was reported, while we observed a reduction of MMP-9 activity (Fig. 1c). The reason for this discrepancy might lay with the duration of doxycycline treatment, since another study showed a decrease in MMP-9 protein expression after 2 weeks of doxycycline treatment (Lindeman et al., 2009). Longer, 3 month duration therapy with doxycycline prevented the growth of the abdominal aortic aneurysm as measured in follow up testing 12 and 18 months after treatment (Mosorin et al., 2001). However, at 6 months follow up testing, no detectable effect was revealed yet. Side effects of long term treatment with 150 mg/day doxycycline in people were generally low: 8% incidence of cutaneous photosensitivity, 3% tooth discoloration, 3% yeast infection (Baxter et al., 2002). Even this low incidence of complications could probably be avoided when doxycycline is used in subantimicrobial doses, which also effectively reduce the MMP activity (Brown et al., 2004). Doxycycline is the only FDA approved MMP-inhibitor for the treatment of periodontal disease and rosacea. Periodontal disease is treated with 20 mg once daily doxycycline (Periostat®). Rosacea is treated with 30 mg immediate release and 10 mg delayed release beads of doxycycline (Oracea®). Some studies using either 20 mg twice daily (Bikowski, 2003; Thiboutot et al., 2009) or 40 mg once daily (Del Rosso et al., 2007) for the treatment of Page 13 of 26 JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx rosacea reported no adverse events. The comparison of 100 mg versus 40 mg doxycycline once daily for the treatment of rosacea revealed significant less adverse events in the 40 mg group (Del Rosso et al., 2008). However, doxycycline long-term therapy has been used safely in patients with rosacea and acne vulgaris. Minor side effects are varied (summarized in (Valentin et al., 2009); serious side effects are rare (Sloan and Scheinfeld, 2008). Furthermore, doxycycline therapy with 100 mg twice daily up to 2 years decreased hemorrhagic risk in brain vascular malformations (Frenzel et al., 2008). Doxycyclin therapy with the same dosage reduced aortic neck dilatation 6 months after endovascular aneurysm repair (Hackmann et al., 2008). Clinical trials with other applications of doxycycline are on the way. On the basis of the presented data it is difficult to distinguish whether increased total MMP and active MMP-9 in carotid arteries of heterozygous mice was a result of increased ECM turnover in heterozygous mice or a response to stressing of the vascular system by physically manipulating the aorta. The former hypothesis is more probable, because of
elevated urine concentration of carboxy-terminal peptide of collagen I in heterozygous males
(Cooper et al., 2010), and increase of the total MMP activity in the skin shown in our
experiment, indicate that changes in collagen turnover are observed not only in the vascular
system, but outside it as well. However, to our knowledge there have been no studies
evaluating MMP activity in the serum of vEDS patients. Nevertheless, an elevated MMP-9
activity was found in abdominal aortic aneurysms among general population (Thompson et
al., 1995; Yamashita et al., 2001). This activity was localized to infiltrating adventitial
macrophages (Thompson et al., 1995). The absence of active MMP-9 in the skin in wild-type
and heterozygous mice (Fig. 5) might be explained by the absence of inflammation and
macrophage infiltration. Matrix metalloproteinase-2 is unique in its ability to degrade both
elastin and fibrillar collagen
Page 14 of 26
JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx
(Kadoglou and Liapis, 2004). Mesenchymal cells (including vascular smooth muscle cells)
constitutively express MMP-2, but other cell types like macrophages and fibroblasts produce
small amounts of it. The main cellular sources of MMP-2 are located in the media and
adventitia of the aortic wall facilitating the destruction of elastin and collagen fibres and the
disorganization of the aortic wall structure in AAA (Kadoglou and Liapis, 2004). Failure to
observe increased MMP-2 activity in our model (Fig. 1c) may be because the actual vascular
lesions were not sufficiently severe. The activity was rarely elevated in vivo in abdominal
aortic aneurysm in patients (Thompson et al., 1995). It was also increased in vitro in vascular
smooth muscle cells isolated from abdominal aortic aneurysm (Crowther et al., 2000).
In our experiment, doxycycline prevented an increase in MMP activity in the vascular wall, as
was seen for MMP-9 in carotid artery. These results are compatible with reported reduction
of MMP-9 activity in serum of patients with abdominal aortic aneurysm treated with
doxycycline (Baxter et al., 2002). Moreover, the activity of MMP- 9 was reduced only in
patients whose MMP-9 levels were elevated before the start of doxycycline treatment.
Interestingly, the reported lack of doxycycline effect on normal MMP levels was in
concordance with our observation on skin MMP activity: the normal levels of MMP activity in
the skin of HT mice was not affected by doxycycline treatment and thus, accumulation of the
collagen in the skin was not induced. Furthermore, doxycycline treatment did not alleviate the
weakness of heterozygous mouse colon as determined by biomechanical measurements.
The outcomes of this measurement support the hypothesis that effects of doxycycline might
be tissue- or age- specific in preventing pathology. For instance, the biomechanical
properties of the abdominal aorta were not yet different between HT and WT mice at 9
months, but did differ at 21 months of age (Cooper et al., 2010).
Page 15 of 26
JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx
In our mouse model the reduction of MMP activity in the vessel was accompanied by
reduced MMP concentration in the skin, while MMP concentration in serum was not affected.
This suggests a possibility to monitor the progression of potential doxycycline treatment of
vEDS patients by skin biopsy, if MMP activity would not be elevated in the serum of vEDS
patients.
Doxycycline prevents the excess of stress induced vessel pathology in mice haploinsufficient
for Col3a1 by inhibiting activity of tissue MMP-9 and thus, reducing the degradation of the
elastic matrix. The results suggest that doxycycline merits clinical testing as a possible
treatment for vEDS.
Limitation
The efficacy of proposed doxycycline therapy was tested in the haploinsufficient mouse
model. Therefore, it definitely can be proposed as a potential treatment for only a small
subset of vEDS patients with haploinsufficiency for COL3A1. Whether this treatment can be
successful in the rest of vEDS patients shall be tested in the appropriate genetic mouse
model yet to be developed. However, doxycycline treatment was successful in another
mouse model with a mutation in a protein of the extracellular matrix causing aortic ruptures: a
mouse model of Marfan syndrome based on a mutation in fibrilin-1 (Fbn1C1039/+) (Chung et
al., 2008; Xiong et al., 2008; Yang et al., 2010).
Acknowledgements
The statistical calculation of the vessel pathology by Chris Morell (NIA) and the technical
assistance of Tia Turner (NIA) and Shannon Marshall (NIA) are greatly appreciated.
Page 16 of 26
JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx
Authorship Contribution
Participated in research design: Briest, McDonnell and Talan. Conducted experiments:
Briest, Cooper, Tae and Krawczyk. Performed data analysis: Briest, Cooper, Tae and
Krawcyk. Wrote or contributed to the writing of the manuscript: Briest, Cooper, Tae and
Talan.
The authors declared that they had no conflicts of interests with respect to their authorship or
the publication of this article.
Page 17 of 26
JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx
References
Baxter BT, Pearce WH, Waltke EA, Littooy FN, Hallett JW, Jr., Kent KC, Upchurch GR, Jr.,
Chaikof EL, Mills JL, Fleckten B, Longo GM, Lee JK and Thompson RW (2002) Prolonged
administration of doxycycline in patients with small asymptomatic abdominal aortic
aneurysms: report of a prospective (Phase II) multicenter study. J Vasc Surg 36:1-12.
Bikowski JB (2003) Subantimicrobial dose doxycycline for acne and rosacea. Skinmed
2:234-245.
Briest W, Hölzl A, Raßler B, Deten A, Leicht M, Baba HA and Zimmer H-G (2001) Cardiac
remodeling after long term norepinephrine treatment in rats. Cardiovasc Res 52:265-273.
Brooke BS (2010) Celiprolol therapy for vascular Ehlers-Danlos syndrome. Lancet 376:1443-
1444.
Brown DL, Desai KK, Vakili BA, Nouneh C, Lee HM and Golub LM (2004) Clinical and
biochemical results of the metalloproteinase inhibition with subantimicrobial doses of
doxycycline to prevent acute coronary syndromes (MIDAS) pilot trial. Arterioscler Thromb
Vasc Biol 24:733-738.
Chung AW, Yang HH, Radomski MW and van Breemen C (2008) Long-term doxycycline is
more effective than atenolol to prevent thoracic aortic aneurysm in marfan syndrome through
the inhibition of matrix metalloproteinase-2 and -9. Circ Res 102:e73-85.
Cooper TK, Zhong Q, Krawczyk M, Tae HJ, Muller GA, Schubert R, Myers LA, Dietz HC,
Talan MI and Briest W (2010) The haploinsufficient - Col3a1 mouse is a model for vascular
Ehlers-Danlos syndrome. Vet Pathol 47:1028-1039.
Page 18 of 26
JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx
Crowther M, Goodall S, Jones JL, Bell PR and Thompson MM (2000) Increased matrix
metalloproteinase 2 expression in vascular smooth muscle cells cultured from abdominal
aortic aneurysms. J Vasc Surg 32:575-583.
Curci JA, Mao D, Bohner DG, Allen BT, Rubin BG, Reilly JM, Sicard GA and Thompson RW
(2000) Preoperative treatment with doxycycline reduces aortic wall expression and activation
of matrix metalloproteinases in patients with abdominal aortic aneurysms. J Vasc Surg
31:325-342.
Del Rosso JQ, Schlessinger J and Werschler P (2008) Comparison of anti-inflammatory
dose doxycycline versus doxycycline 100 mg in the treatment of rosacea. J Drugs Dermatol
7:573-576.
Del Rosso JQ, Webster GF, Jackson M, Rendon M, Rich P, Torok H and Bradshaw M (2007)
Two randomized phase III clinical trials evaluating anti-inflammatory dose doxycycline (40-
mg doxycycline, USP capsules) administered once daily for treatment of rosacea. J Am Acad
Dermatol 56:791-802.
Frenzel T, Lee CZ, Kim H, Quinnine NJ, Hashimoto T, Lawton MT, Guglielmo BJ, McCulloch
CE and Young WL (2008) Feasibility of minocycline and doxycycline use as potential
vasculostatic therapy for brain vascular malformations: pilot study of adverse events and
tolerance. Cerebrovasc Dis 25:157-163.
Germain DP (2007) Ehlers-Danlos syndrome type IV. Orphanet J Rare Dis 2:32. Hackmann
AE, Rubin BG, Sanchez LA, Geraghty PA, Thompson RW and Curci JA
(2008) A randomized, placebo-controlled trial of doxycycline after endoluminal
aneurysm repair. J Vasc Surg 48:519-526; discussion 526. Kadoglou NP and Liapis CD
(2004) Matrix metalloproteinases: contribution to
pathogenesis, diagnosis, surveillance and treatment of abdominal aortic aneurysms. Curr
Med Res Opin 20:419-432.
Page 19 of 26
JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx
Khalique Z, Lyons OT, Clough RE, Bell RE, Reidy JF, Schwarze U, Byers PH and Taylor PR
(2009) Successful Endovascular Repair of Acute Type B Aortic Dissection in Undiagnosed
Ehlers-Danlos Syndrome Type IV. Eur J Vasc Endovasc Surg 38:608-609.
Lindeman JH, Abdul-Hussien H, van Bockel JH, Wolterbeek R and Kleemann R (2009)
Clinical trial of doxycycline for matrix metalloproteinase-9 inhibition in patients with an
abdominal aneurysm: doxycycline selectively depletes aortic wall neutrophils and cytotoxic T
cells. Circulation 119:2209-2216.
Liu X, Wu H, Byrne M, Krane S and Jaenisch R (1997) Type III collagen is crucial for
collagen I fibrillogenesis and for normal cardiovascular development. Proc Natl Acad Sci U S
A 94:1852-1856.
Mosorin M, Juvonen J, Biancari F, Satta J, Surcel HM, Leinonen M, Saikku P and Juvonen T
(2001) Use of doxycycline to decrease the growth rate of abdominal aortic aneurysms: a
randomized, double-blind, placebo-controlled pilot study. J Vasc Surg 34:606-610.
Ong KT, Perdu J, De Backer J, Bozec E, Collignon P, Emmerich J, Fauret AL, Fiessinger JN,
Germain DP, Georgesco G, Hulot JS, De Paepe A, Plauchu H, Jeunemaitre X, Laurent S and
Boutouyrie P (2010) Effect of celiprolol on prevention of cardiovascular events in vascular
Ehlers-Danlos syndrome: a prospective randomised, open, blinded-endpoints trial. Lancet
376:1476-1484.
Pepin M, Schwarze U, Superti-Furga A and Byers PH (2000) Clinical and genetic features of
Ehlers-Danlos syndrome type IV, the vascular type. N Engl J Med 342:673-680.
Pope FM, Martin GR, Lichtenstein JR, Penttinen R, Gerson B, Rowe DW and McKusick VA
(1975) Patients with Ehlers-Danlos syndrome type IV lack type III collagen. Proc Natl Acad
Sci U S A 72:1314-1316.
Page 20 of 26
JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx
Pyeritz RE (2000) Ehlers-Danlos syndrome. N Engl J Med 342:730-732. Sastry PS (2002)
Matrix metalloproteinase inhibitor therapy to prevent complications as
well as therapy for Ehler-Danlos syndrome. Med Hypotheses 59:314-315. Schwarze U,
Schievink WI, Petty E, Jaff MR, Babovic-Vuksanovic D, Cherry KJ, Pepin
M and Byers PH (2001) Haploinsufficiency for one COL3A1 allele of type III procollagen
results in a phenotype similar to the vascular form of Ehlers-Danlos syndrome, Ehlers-
Danlos syndrome type IV. Am J Hum Genet 69:989-1001.
Seeland U, Selejan S, Engelhardt S, Muller P, Lohse MJ and Bohm M (2007) Interstitial
remodeling in beta1-adrenergic receptor transgenic mice. Basic Res Cardiol 102:183-193.
Sloan B and Scheinfeld N (2008) The use and safety of doxycycline hyclate and other
second-generation tetracyclines. Expert Opin Drug Saf 7:571-577.
Smith LT, Schwarze U, Goldstein J and Byers PH (1997) Mutations in the COL3A1 gene
result in the Ehlers-Danlos syndrome type IV and alterations in the size and distribution of
the major collagen fibrils of the dermis. J Invest Dermatol 108:241- 247.
Stenson PD (2009) The Human Gene Mutation Database at the Institute of Medical Genetics
in Cardiff, in, Cardiff University.
Thiboutot DM, Fleischer AB, Del Rosso JQ and Rich P (2009) A multicenter study of topical
azelaic acid 15% gel in combination with oral doxycycline as initial therapy and azelaic acid
15% gel as maintenance monotherapy. J Drugs Dermatol 8:639- 648.
Thompson RW and Baxter BT (1999) MMP inhibition in abdominal aortic aneurysms.
Rationale for a prospective randomized clinical trial. Ann N Y Acad Sci 878:159- 178.
Page 21 of 26
JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx
Thompson RW, Holmes DR, Mertens RA, Liao S, Botney MD, Mecham RP, Welgus HG and
Parks WC (1995) Production and localization of 92-kilodalton gelatinase in abdominal aortic
aneurysms. An elastolytic metalloproteinase expressed by aneurysm-infiltrating
macrophages. J Clin Invest 96:318-326.
Valentin S, Morales A, Sanchez JL and Rivera A (2009) Safety and efficacy of doxycycline in
the treatment of rosacea. Clinical, Cosmetic and Investigational Dermatology 2:129-140.
Watanabe A, Kosho T, Wada T, Sakai N, Fujimoto M, Fukushima Y and Shimada T (2007)
Genetic aspects of the vascular type of Ehlers-Danlos syndrome (vEDS, EDSIV) in Japan.
Circ J 71:261-265.
Watanabe A and Shimada T (2008) Vascular type of Ehlers-Danlos syndrome. J Nippon Med
Sch 75:254-261.
Weinbrenner C, Nelles M, Herzog N, Sarvary L and Strasser RH (2002) Remote
preconditioning by infrarenal occlusion of the aorta protects the heart from infarction: a newly
identified non-neuronal but PKC-dependent pathway. Cardiovasc Res 55:590-601.
Wennstrom JL, Newman HN, MacNeill SR, Killoy WJ, Griffiths GS, Gillam DG, Krok L,
Needleman IG, Weiss G and Garrett S (2001) Utilisation of locally delivered doxycycline in
non-surgical treatment of chronic periodontitis. A comparative multi-centre trial of 2 treatment
approaches. J Clin Periodontol 28:753-761.
Xiong W, Knispel RA, Dietz HC, Ramirez F and Baxter BT (2008) Doxycycline delays
aneurysm rupture in a mouse model of Marfan syndrome. J Vasc Surg 47:166- 172;
discussion 172.
Yamashita A, Noma T, Nakazawa A, Saito S, Fujioka K, Zempo N and Esato K (2001)
Enhanced expression of matrix metalloproteinase-9 in abdominal aortic aneurysms. World J
Surg 25:259-265.
Page 22 of 26
JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx
Yang HH, Kim JM, Chum E, van Breemen C and Chung AW (2010) Effectiveness of
combination of losartan potassium and doxycycline versus single-drug treatments in the
secondary prevention of thoracic aortic aneurysm in Marfan syndrome. J Thorac Cardiovasc
Surg 140:305-312.
Page 23 of 26
JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx
Footnotes
This Work was supported by the Intramural Research Program of the National Institute on
Aging (NIA) at the National Institutes of Health; and WB was partly supported by research
grants of Gerhard Schuler, Department of Cardiology at the Heart Center, Leipzig, Germany.
Page 24 of 26
JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx
Legends for Figures Figure 1 MMP activity in the carotid artery of wild-type (+/+) and
heterozygous mice (+/-) was analyzed by zymography. Representative zymogram of extracts
from heterozygous mouse carotid artery fed with normal (doxy 0), doxy25 (25) and doxy100
(100) diet (A). All 4 bands were summarized as total MMP (B). Active MMP-9 (C) and active
MMP-2 (D) were analyzed by densitometry. The result was normalized to the protein content.
Data are means ±SEM. *P<0.05 vs. +/+ normal diet, †P<0.05 vs. +/- normal diet, **P<0.001
vs. +/+ normal diet, ††P<0.001 vs. +/- normal diet. Number of animals in each group is
indicated in the respective column in B: total MMP
Figure 2 Heterozygous mice (+/-) had significantly less collagen per unit area than wild- type
in the abdominal aorta (A) as determined by picro-sirius red staining. This reduction was
partially ameliorated in the high dose of doxycycline group. The reduction was seen in the
tunica media (B) and not in the tunica adventitia (C). Data are means ±SEM. *P<0.05 vs. +/+
normal diet. Number of animals in each group is indicated in the respective column.
Figure 3 Cumulative lesion score (lesions ≥ grade 2) in each group demonstrates an
increase in untreated heterozygotes and a dose dependent decrease of vessel pathology in
doxycycline treated groups. A) Section of abdominal aorta from a wild-type control animal.
Massonʼs trichrome. B) A representative grade 4 lesion (indicated by arrows) with a large
defect in the internal elastic lamina and significant subintimal spindle cell proliferation with
deposition of collagen is shown. C) Data are means (WT=17, HT=19, HT-Dox25=10, HT-
Dox100=11) ±SEM. **P<0.001 vs. +/+ normal diet, ††P<0.001 vs. +/- normal diet.
Page 25 of 26
JPET #177782C:\Files\conversion\converted\in\24926712-file00.docx
Figure 4 There was a different pattern in lysis bands in the zymography of serum from
heterozygous and wild-type mice. Representative zymogram of serum from heterozygous
(+/-) and wild-type (+/+) mice (A). All 4 bands were summarized as total MMP (B). Number of
animals in each group is indicated in the respective column.
Figure 5 MMP activities in the skin were elevated in heterozygous mice, and normalized to
the level of wild-type mice after high dose doxycycline treatment. Representative zymogram
of extracts from heterozygote skin (A). All 4 bands were summarized as total MMP (B). Pro-
form of MMP-9 (C) and MMP-2 (D) were analyzed by densitometry. The result was
normalized to amount of tissue used (in mg).
Data are means ±SEM. *P<0.05 vs. +/+ normal diet, †P<0.05 vs. +/- normal diet, **P<0.001
vs. +/+ normal diet, ††P<0.001 vs. +/- normal diet. Number of animals in each group is
indicated in the respective column.
Page 26 of 26

Source: http://www.annabelleschallenge.org/app/download/7084637/Doxycycline+vascular+type+of+Ehlers.pdf