Cekinfo.org.uk

European International Journal of Science and Technology Vol. 1 No. 3 December 2012 Periodontal Statusin Relation to the Pathogens Porphyromonasgingivalis and Tannerella
forsythensis in theThree Main Ethnic Groups in Malaysia.
Luay ThanoonYounis (Corresponding author)
Department of Oral Biology, Faculty of Dentistry, Tara BaiTaiyeb Ali
Oral Medicine & Periodontology, Faculty of Dentistry, University of Malaya,50603 Kuala Lumpur, Malaysia Rohana Yusuf
Department of Molecular Medicine, Faculty of Medicine,
Sponsoring information:
This study is supported by University of Malaya Research Fund 02/11.
Abstract:
Objective:To
periodotopathogensPorphyromonasgingivalis (Pg) and Tannerellaforsythensis (Tf) in the three main
ethnic groups in Malaysia.
Materials and Methods: A total of 44 adult subjects (16 Malays, 16 Indians and 12 Chinese) aged 35-65
years were selected. Periodontitis patients (PP) were associated with pocket depth of ≥ 6mm at ≥ 4 sites.
Healthy subjects (HS) had probing depths ≤ 3mm and no evidence of attachment loss clinically or bone
loss radiographically. Subgingival plaque samples were taken from the deepest pockets ≥ 6mm in the
periodontitis subjects and from areas without bleeding upon probing in the healthy subjects. Clinical
parameters included plaque index, gingivitis index, bleeding on probing, probing pocket depth, clinical
attachment level, and number of missing teeth were measured.The presence of Pg&Tf was assessed by
polymerase chain reaction.
Results: The prevalence of Pgand Tfin the Indians was highest (Pg 75%, Tf 62.5%), followed by the
Chinese (Pg53.8%, Tf 50%) and the Malays (Pg 43.8%, Tf 50%). The differences among PP were
European International Journal of Science and Technology Vol. 1 No. 3 December 2012
significant for prevalence of Tf (P <0.05) and among HS were significant for prevalence of Pg (P <0.05).
The Indian participants were associated with higher levels of periodontal clinical scores as compared to
the subjects of the other 2 ethnic groups.
Conclusion:The study suggests that there are ethnic differences in bacterial colonization of periodontal
pockets both in disease & health participants. It was also noted that the Indians were highly predisposed
to periodontal infection byPg&Tf.

Keywords: Periodontal disease, periodotopathogens. Porphyromonasgingivalis, Tannerellaforsythensis.

1. Introduction:
A large number of epidemiological studies have led to the widely accepted conclusion that the prevalence
and severity of periodontal disease differed in different populations (Ali et al., 1997; Baelum et al., 1996;
Dzink et al., 1988). Knowledge of the variability of disease occurrence between and within populations is
important because such knowledge may assist in identifying the determinants in disease occurrence.
Marked differences between populations would indicate the causes of disease are not inevitable.
Multiple risk markers or putative risk factors for periodontal diseases have been examined in many
studies (Beck et al., 1990; Graig et al., 2002, Meurman et al., 1997). Increased odds ratios for severe
disease has been documented for certain “background” factors (Offenbacher, 1996) such as ethnic group,
low socioeconomic or educational status, certain systemic conditions such as diabetes; smoking; and
occurrence
Bacteroidesforsythus(Tanerrellaforsythensis), Actinobacillusactinomycetemcomitansand Prevotellaintermediain subgingival plaque (Dahlen et al., 1988). Porphyromonasgingivalisand
Tanerrellaforsythensisoccurs in elevated proportions in periodontal pockets experiencing active
periodontal breakdown and possess numerous virulence factors (Ebersole et al., 2008;Grenier et al.,
1995; Schenkein et al., 1993).
The prevalence of some subgingival periodontal pathogens seem to vary among subjects of different
ethnic backgrounds (Oliver et al., 1991 ;Ebersole et al., 2008; Wara-aswapatiet al., 2009), an observation
which in part may explain the race/ethnicity-related differences in periodontal disease severity.
Differences in global periodontal disease severity, in part, may be due to varying oral hygiene practices.
There may also be a possibility that certain populations harbour high levels of particularly virulent
periodontal microorganisms.
Pgand Tf are the strongest bacterial markers for destructive periodontal disease and have been isolated
frequently in subjects with periodontitis and sometimes in those without disease (20). Retrospective
studies have suggested that microbiological assays for critical levels of the target bacteria such as Pgand
Tfmight be of diagnostic value (Jenkinson&Dymok, 1999; Papapanou, 1998; Shelburne et al., 2008).
The purpose of this study was to assess the periodontal status in the 3 main ethnic groups in Malaysia in
relation to the identified pathogens, Pgand Tf.

2. Materials and Methods
2.1 Study sample and patient selection
A cross-sectional study was carried out on subjects who were referred to the Specialist Clinic, Faculty of
Dentistry, University of Malaya. All subjects received detailed information sheet concerning the nature of
European International Journal of Science and Technology Vol. 1 No. 3 December 2012 procedures involved in the study. Informed consent of the patients was obtained according to the ethical guidelines of the Medical Ethical Committee at the Faculty of Dentistry, University of Malaya. Ethical approval was obtained prior to the commencement of the study [Ethics approval No. DFPE0301/0002(P)].Inclusion criteria required subjects who were of Malay, Indian or Chinese descent, aged between 35 to 65 years, had a minimum of 20 teeth, had not received periodontal or antibiotic therapy within the previous six months, female participants were not pregnant, and did not require antibiotic prophylaxis before dental treatment.The study sample included 16 Malays, 16 Indians and 12 Chinese. The diseased subjects (22 subjects) were those diagnosed with advanced chronic periodontitis who were matched by ethnicity, age and gender with periodontally healthy subjects (22 subjects). Periodontitis patients were selected among those presenting with probing depths of ≥ 6 mm at ≥ 4 teeth (van Winkelhoffet al. 2002), bleeding on probing and radiographic evidence of bone loss at these sites. The periodontally healthy subjects were those with probing depths of ≤ 3mm, gingivitis score of <20% and no evidence of attachment loss either clinically or radiographically (Slots &Listgarten, 1988). 2.2 Clinical measurements
A series of clinical indices were used to record the baseline clinical measurements for the involved teeth
excluding the third molars. The plaque index and gingivitis index included 4 sites of the tooth, while,
bleeding index, probing pocket depth and loss of attachment assessment were carried out at 6 sites of the
tooth using William’s periodontal probe.
2.3 Collection of Subgingival Plaque Samples
Supragingival plaque was first removed from the sample site with a hand currette. The site was then
cleaned with cotton pellets and dried. The subgingival plaque was then collected with sterile Gracey
curettes applied to the root surface. In the periodontitis group, subgingival plaque was obtained from 8-12
pockets (per patient) with ≥ 6 mm probing depth. In the periodontally healthy group, subgingival plaque
was collected from 9-10 sites (for each subject) that did not show any sign of bleeding on probing (Slots
&Ting, 1999). Subgingival plaque samplewas pooled and resuspended in a tube containing 1 ml of 10%
phosphate buffer solution and stored at – 80 oC to be assessed later by polymerase chain reaction (PCR).
2.4 Polymerase Chain Reaction Protocol
Patients’ plaque samples were thawed and then centrifuged at 2100 x g for 15 sec, and a 5 µl aliquot of
the supernatant were added to the PCR reaction mixture (Loesche et al., 1992). Hot start technique was
utilized to obtain maximum sensitivity and specificity.The primers wereselected from the DNA sequence
of the fimbrial protein ofP. gingivalis and were used at a final concentration of250ng/25 µL reaction
mixture (Meurman et al., 1997). Senseprimer was 5' ATAATGGAGAACAGCAGGAA 3', and
theantisense primer was 5' TCTTGCCAACCAGTTCCATTGC3'. For T. Forsythensis, The
followingprimers were selected: upper primer, 5' AAA ACA GGG GTTCCG CAT GG 3' (identical to the
upper strand, bases 180-199;the respective bases in E. coli 16S rRNA sequence are 148-167);and lower
primer, 5' TTC ACC GCG GAC TTA ACA GC 3'(identical to the lower strand, bases 586-605; the
respectivebases in E. coli 16S rRNA sequence are 568-587). The thermocycler used in this study was
PTC-100 Programmable Thermal Controller (MJ Research, Inc., Watertown, MA, USA). The completed
reactions were chilled to 4oC.Ten µl of the PCR reaction products from each reaction tube were then
mixed with 2 µl of orange blue loading dye and loaded into the tank wells containing 1.5% agarose gel
European International Journal of Science and Technology Vol. 1 No. 3 December 2012
stained with 10mg/ml ethidium bromide. After 45 min of electrophoresis at 100V, the gel was placed in
the gel analyzer and the PCR products were visualized by UV illumination to detect the presence of
426bp and 131bp PCR products for Tfand Pgrespectively.

2.4.1Polymerase Chain Reaction Quality Control
The negative control was a standard PCR mixture with the plaque sample being replaced by 5 µL of
sterile deionized water. The positive control used was a standard PCR reaction mixture containing either 5
µL of Tfor Pg cellsinstead of the sample. The bacterial strains (TfATCC 43037 and Pg ATCC 33277)used
as positive controls were obtained from the Oral Microbiology Services Laboratory at the Institute of
Dentistry, University of Helsinki, Finland.
2.5 Statistical Analysis
Statistical differences among groups were determined using Kruskal-Wallis test for non-parametric
variables and one way ANOVA was used for parametric data.To examine the relationships between the
presence of the specific bacteria and the level of the clinical scores (PI, GI, BS, CAL, PPD, and number of
missing teeth), 2-sided 2-sample t-test was used to compare the mean clinical scores of subjects in whom
the bacteria were positively or negatively identified.

3. Results
The prevalence of Tf in the subgingival plaque of the Indian subjects was highest (62.5%) as compared to
the Chinese (50%) and Malay subjects (50%) which however was not significant. The difference among
the diseased subjects of the 3 ethnic groups was significant for the prevalence of Tf (p<0.05), but was not
significant for the prevalence of Pg. The difference among healthy subjects was significant for the
prevalence of Pg (p<0.05), but was not significant for Tf(analysis with the Kruskal-Wallis test) as shown
in Table 1.
3.1 Mean clinical scores in Pgand Tfpositive or negative subjects
In the Malay subjects (diseased and healthy), all clinical scores were higher in Pg and Tf-positive subjects;
which were significant for all clinical scores (except for missing teeth and BOP) in Pg-positive subjects,
while it was significant only for GS in Tf-positive subjects. All clinical scores in the Chinese (diseased
and healthy), were higher in Pgand Tf-positive subjects except for the mean of missing teeth which was
higher in Pgand Tf-negative subjects. However, all the differences between the Pgand Tf-negative
subjects were not significant.In the Indians (diseased and healthy), all clinical scores were higher in
Pgand Tf-positive subjects (Tables 8 and 9). PS, GS, CAL measurements, BOP scores were significantly
higher in Pg-positive subjects (p < 0.05). However, all the clinical scores were not statistically significant
in Tf-positive Indian subjects (p > 0.05) as shown in Table 2.

4. Discussion
A prospective cross-sectional study was conducted on diseased participants who were matched by
ethnicity, age and gender with healthy participants. The periodontal pathogens Pg and Tf were detected by
hot start PCR technique which provides reasonably sensitive and specific measures of the putative
pathogens that are present in the periodontal pockets. It has been estimated that about half of
microorganisms present in the dental plaque are unculturable, which is a major obstacle to the
European International Journal of Science and Technology Vol. 1 No. 3 December 2012
understanding of the etiology of periodontal infection. Therefore, molecular biology techniques have been
introduced as highly specific means for the detection of periodontopathic bacteria.The prevalence rate
may be affected by the choice of detection method, with recognized differences in sensitivity and
specificity between methods (Loesche et al., 1992). This study revealed that deep pockets were not a
prerequisite ecological environments for colonization by putative pathogens (Dahlen et al., 1992),
although these species were recovered more frequently from deeper sites & from diseased subjects.
Pathogens are often carried in low numbers in mouths free of destructive periodontal diseases (the so-
called “carrier state”), making their role in disease more difficult to evaluate.
In the present study, it appeared that P. gingivalisand T. forsythensiswere identified in a number of the
healthy subjects with no clinical periodontal symptoms observed. In healthy subjects, the number of
pathogens may be very low which however can be detected by PCR technique, but detection of their
presence may identify these subjects as carriers and are at risk of developing periodontitis in the future
(van Winkelhoff et al., 2002). The study suggests that there are ethnic differences in the bacterial
colonization of periodontal pockets both in disease & health. The results indicated that 87.5% of the
Indian healthy subjects appeared to have a significant prevalence of Pg (p<0.05) as compared to the
healthy Malays and Chinese, indicating a possible greater potential in future breakdown of the
periodontium of the Indians. In addition, the prevalence of Tfin the Indian diseased subjects was
significant (p< 0.05) as compared to diseased Malays and Chinese correlating to the greater extent of
periodontal destruction in this ethnic group.
The relationship between the presence of specific bacteria and the level of clinical scores was investigated.
In the diseased group, the mean PS, GS, BOP, CAL, PPD and number of missing teeth were higher in
Pgand Tf-positive patients as compared to Pgand Tf-negative patients.In the healthy groups, Tf–positive
subjects were associated with higher means of plaque and gingival scores as compared to Tf-negative
healthy subjects. In Pg-positive healthy individuals, mean PS and GS were higher than in Pg-negative
subjects, which however were not significant. This indicates that diseased subjects with these pathogens
had greater periodontal destruction reinforcing observations by other investigators on these organisms
pathogenicity (Wilson et al., 1995; Meurman et al., 1997; Holt et al., 1999).
A higher number of Indian subjects were found to harbourPgand Tf more than the Malays and Chinese,
which may explain, to a certain extent, why the Indian subjects had a higher level of clinical periodontal
destruction as compared to the participants of the other 2 ethnic groups.

5. Conclusion
P. gingivalis& T. forsythensiswere more prevalent in the diseased than healthy subjects. The study
suggests that there are ethnic differences in bacterial colonization of periodontal pockets both in disease &
health. It was also noted that the Indians were highly predisposed to periodontal infection by
bothPg&Tfand were associated with higher levels of clinical scores as compared to the Malays & Chinese.
P. gingivalis&T. forsythensiswere identified in a number of control subjects. This may indicate that the
deep pockets are not a prerequisite for colonization by putative pathogens and the presence of periodontal
pathogens may be associated with no clinical signs.
Acknowledgment
This study is supported by University of Malaya Research Fund 02/11.
European International Journal of Science and Technology Vol. 1 No. 3 December 2012
References
Ali, R.W.,Johannessen, A.C.,Dahlen, G.,Socransky, S.S.,Skaug N. (1997). Comparison of the
subgingivalmicrobiota of periodontally healthy and diseased adults in Northern Cameroon.J
ClinPeriodontol.24: 830-835.
Baelum, V., Chen, X.,Manji, F., Luan, W.M.,Fejrskov, O. (1996).Profiles of destructive periodontal
disease in different populations.J Periodont Res. 31: 17-26.
Beck, J.D.,Koch, G.G.,Zambon, J.J.,Genco, R.J., Tudor, G.E. (1990).Evaluation of oral bacteria as risk
indicators for periodontitis in older adults.J Periodontol.63: 93-99.
Dahlén, G.,Lindhe, J.,Sato, K.,Hanamura, H.,Okamoto, H. (1992).The effect of supragingival plaque
control on the subgingivalmicrobiota in subjects with periodontal disease.J ClinPeriodontol.19(10):802-9.
Dzink, J.L.,Socransky, S.S.,Haffajee, A.D. (1988).The predominant cultivable microbiota of active and
inactive lesions of destructive periodontal diseases.J ClinPeriodontol.15(5):316-23.
Ebersole, J.L., Holt, S.C., Hansard, R., Novak, M.J.(2008).Microbiologic and immunologic characteristics
of periodontal disease in Hispanic americans with type 2 diabetes.J Periodontol.79(4):637-46.
Graig, R.G.,Boylan, R., Yip, J.,Mijares, D., Imam, M.,Socarnsky, S.S.,Taubman, M.A.,Haffajee, A.D.
(2002). Serum IgG antibody response to periodontal in minority populations: relationship to periodontal
status and progression. J Periodont Res. 37(2):132-46.
Grenier, D., Bertrand, J.,Mayrand,D. (1995).Porphyromonasgingivalis outer membrane vesicles promote
bacterial resistance to chlorhexidine. Oral MicrobiolImmunol.10(5):319-20.

Grossi, S.G.,Zambon, J.J.,Ho, A.W., Koch, G.,Dunford, R.G.,Machtei, E.E.,Norderyd, O.M.,Genco, R.J.
(1994).Assessment of risk for periodontal disease. I. Risk indicators for attachment loss. J
Periodontol.65(3):260-7.
Holt, S.C.,Kesavalu, L., Walker, S.,Genco, C.A. (1999). Virulence factors of Porphyromonasgingivalis.
Periodontol 2000.20:168-238.
Jenkinson, H.F.&Dymok, D. (1999). The microbiology of periodontal disease.Dent Update. 26: 191-197.
Loesche, W.J.,Lopatin, D.E., Giordano, J., Alcoforado, G.,Hujoel, P. (1992).Comparison of the benzoyl-
DL-arginine-naphthylamide (BANA) test, DNA probes, and immunological reagents for ability to detect
European International Journal of Science and Technology Vol. 1 No. 3 December 2012 andBacteroidesforsythus.J ClinMicrobiol.30(2):427-33.
Meurman, J.H.,Wahlfors, J.,Korhonen, A.,Alakuijala, P.,Vaisanen, P.,Torkk, H.,Janne, J. (1997).
Identification of Bacteroidesforsythusin subgingival dental plaque with the aid of a rapid PCR method.J
Dent Res. 76(7):1376-80.
Offenbacher, S. (1996).Periodontal diseases: pathogenesis. Ann Periodontol. 1 (1): 821-78.
Oliver, R.C.,Tervonen, T., Flynn, D.G., Keenan, K.M. (1991).Enzyme activity in crevicular fluid in
relation to metabolic control of diabetes and other periodontal risk factors.J Periodontol.64(5):358-62.
Papapanou, P.N.(1998). Risk assessments in the diagnosis and treatment of periodontal diseases.J Dent
Educ.62(10):822-39.
Schenkein, H.A.,Burmeister, J.A.,Koertge, T.E., Brooks, C.N., Best, A.M., Moore, L.V.H., Moore,
W.E.C. (1993).The influence of race and gender on periodontal microflora.J Periodontol.64: 292-296.
Shelburne, C.E., Shelburne, P.S., Dhople, V.M., Sweier, D.G., Giannobile, W.V., Kinney, J.S., Coulter,
W.A., Mullally, B.H., Lopatin, D.E. (2008). Serum antibodies to Porphyromonasgingivalis chaperone
HtpG predict health in periodontitis susceptible patients.PLoS One3(4):e1984.
Slots,
Actinobacillusactinomycetemcomitans in human periodontal diseases.J ClinPeriodontol.15(2):85-93.
Slots, J.& Ting, M. (1999).Actinobacillusactinomycetemcomitans and Porphyromonasgingivalis in human
periodontal disease: occurrence and treatment. Periodontol 2000.20:82-121.
Tan, K.S., Song, K.P.,Ong, G. (2001). BacteroidesforsythusprtH genotype in periodontitis patients:
occurrence and association with periodontal disease. J Periodont Res.36: 398-403.
vanWinkelhoff, A.J., Loos, B.G., van der Reijden,W.A., van der velden, U. (2002).
Porphyromonasgingivalis, Bacteroidesforsythus and other putative periodontal pathogens in subjects with
and without periodontal destruction.J ClinPeriodontol.29 (11):1023-8.
Wara-aswapati, N., Pitiphat.W., Chanchaimongkon, L., Taweechaisupapong, S., Boch, J.A., Ishikawa, I.
(2009).Red bacterial complex is associated with the severity of chronic periodontitis in a Thai
population.Oral Diseases15(5):354-9.
Watanabe, K.&Frommel, T.O.(1993). Detection of Porphyromonasgingivalis in oral plaque samples by
use of the polymerase chain reaction.J Dent Res.72(6):1040-4.
European International Journal of Science and Technology Vol. 1 No. 3 December 2012
Wilson, M.E., Bronson, P.M., Hamilton, R.G. (1995). Immunoglobulin G2 antibodies promote neutrophil
killing of Actinobacillusactinomycetemcomitans. Infect Immun.63(3):1070-5.
Zambon, J.J. (1996). Periodontal diseases: microbial factors. Ann Periodontol.1: 879-925.
Table 1: Prevalence of Pgand Tfin the Malay, Chinese and Indian subjects
P
g
T
f
HS: Healthy subjects; CP: Chronic periodontitis patients, n: number of subjects K.W: Kruskal-Wallis test. ∗ : Significant differences among healthy or disease subjects European International Journal of Science and Technology Vol. 1 No. 3 December 2012 Table 2: Mean clinical scores in Pgand Tfpositive or negative subjects Mean Clinical Score Mean Clinical Score Mean Clinical Score * = p < 0.05 PS plaques score, GS gingival score, PPD probing pocket depth, BOP bleeding on probing.

Source: http://cekinfo.org.uk/images/frontImages/gallery/Vol1No3December2012/10.pdf